Biopython

1.87 · active · verified Thu Apr 09

Biopython is a comprehensive collection of freely available Python tools for computational molecular biology and bioinformatics. It provides functionality for common tasks such as parsing various bioinformatics file formats (e.g., FASTA, GenBank, BLAST), interacting with online biological databases (e.g., NCBI Entrez), working with sequences and alignments, and structural bioinformatics. Currently at version 1.87, it is actively maintained with several releases per year.

Warnings

breaking The `Bio.Alphabet` module was removed in Biopython 1.78 (September 2020). Explicit `alphabet` arguments for `Seq` objects are no longer supported, and molecule type is often inferred or stored as a string in `SeqRecord.annotations['molecule_type']`.
Fix: Remove `alphabet` arguments from `Bio.Seq.Seq` constructors. Access molecule type via `SeqRecord.annotations.get('molecule_type')` if needed.
breaking The `Bio.Fasta` module was deprecated in Biopython 1.51 (August 2009) and removed in Biopython 1.55 (August 2010).
Fix: Migrate code to use `Bio.SeqIO.parse()` or `Bio.SeqIO.read()` with `format='fasta'` for FASTA file parsing.
breaking Support for Python 2.7 was dropped in Biopython 1.77 (2020), in line with Python 2.7's end-of-life.
Fix: Upgrade to Python 3.10 or newer. Biopython 1.87 officially supports Python 3.10-3.14.
deprecated The use of command-line tool wrappers in modules like `Bio.Applications` was deprecated in Biopython 1.78. They are no longer recommended due to potential security and compatibility issues.
Fix: Consider using Python's `subprocess` module directly to call external tools, or investigate dedicated Python wrappers if available.
gotcha FASTA file parsing became stricter in Biopython 1.85, and as of 1.87, lines before the first '>' are no longer interpreted as comments but cause errors if they are not empty. This can break parsing of some non-standard FASTA files.
Fix: Ensure FASTA files strictly start with a `>` character for the first sequence header, or an empty line if not. Remove any preamble text before the first record.
deprecated The `.strand`, `.ref`, and `.ref_db` attributes of `SeqFeature` objects were temporarily removed in Biopython 1.82 without deprecation, then restored with deprecation warnings in 1.83. They are aliases for `.location.strand`, `.location.ref`, and `.location.ref_db` respectively.
Fix: Update code to use `.location.strand`, `.location.ref`, and `.location.ref_db` directly.
deprecated The `setup.py` script for project metadata and build configuration was deprecated in Biopython 1.87 in favor of a `pyproject.toml`-based setup.
Fix: For contributors/developers, build systems should now respect `pyproject.toml`. Standard `pip install` users are unaffected.

Install

pip install biopython Install stable release

Imports

Seq
```
from Bio.Seq import Seq
```
Core sequence object.
SeqIO
```
from Bio import SeqIO
```
Module for reading and writing sequence file formats.
Align
```
from Bio import Align
```
Module for sequence alignment functionality.
PDB
```
from Bio import PDB
```
Module for working with protein structures.
Entrez
```
from Bio import Entrez
```
Module for accessing NCBI's Entrez databases.
Alphabet
```
No direct equivalent
```
The Bio.Alphabet module was removed in Biopython 1.78. Sequence objects now handle molecule type as a string in SeqRecord annotations or by inferring from context. Explicit alphabet arguments should be removed.
Fasta
```
from Bio import SeqIO
```
The Bio.Fasta module was deprecated in 1.51 and removed in 1.55. Use Bio.SeqIO.parse() with format='fasta' instead.

Quickstart

This quickstart demonstrates creating and manipulating a Bio.Seq object, and then parsing a FASTA file using Bio.SeqIO.parse, which is a common task in bioinformatics. It includes creating a temporary FASTA file to make the example runnable.

import os
from Bio.Seq import Seq
from Bio import SeqIO

# 1. Working with a basic sequence
my_dna = Seq("ATGACGTACGT")
print(f"Original DNA: {my_dna}")
print(f"Complement: {my_dna.complement()}")
print(f"Reverse Complement: {my_dna.reverse_complement()}")
print(f"Translated protein: {my_dna.translate()}")

# 2. Parsing a FASTA file
# Create a dummy FASTA file for demonstration
fasta_content = (
    ">seq1 description for sequence 1\n"
    "ATGCGTACGTAGCTAGCTAGCATGCAGCTAGCATGCGATGC\n"
    ">seq2 description for sequence 2\n"
    "GATCGATCGATCGATCGATCGATCGATCGATCGATCGA"
)

with open("example.fasta", "w") as f:
    f.write(fasta_content)

print("\n--- Parsing example.fasta ---")
for seq_record in SeqIO.parse("example.fasta", "fasta"):
    print(f"ID: {seq_record.id}")
    print(f"Description: {seq_record.description}")
    print(f"Sequence: {seq_record.seq}")
    print(f"Length: {len(seq_record.seq)}")

# Clean up the dummy file
os.remove("example.fasta")

view raw JSON →