bioutils
raw JSON → 0.6.1 verified Fri May 01 auth: no python
A library of miscellaneous simple bioinformatics utilities and lookup tables, including codon translation, sequence manipulation, and assembly mapping. Current version 0.6.1, requires Python >=3.10, maintained by biocommons.
pip install bioutils Common errors
error AttributeError: module 'bioutils' has no attribute 'codons' ↓
cause Trying to access bioutils.codons after import bioutils, but submodules need explicit import.
fix
Use 'from bioutils import codons' instead of 'import bioutils' then 'bioutils.codons'.
error ImportError: cannot import name 'translate' from 'bioutils' ↓
cause The correct import is from bioutils.codons, not from bioutils directly.
fix
Use 'from bioutils.codons import translate'.
Warnings
breaking Version 0.6.0 dropped support for Python <3.10 and migrated configuration from setup.cfg to pyproject.toml. If you are on an older Python version, stay on 0.5.x. ↓
fix Upgrade to Python >=3.10 or pin bioutils to <0.6.0.
gotcha Functions like codons.translate() and sequences.reverse_complement() expect plain string input, not Bio.Seq objects. Passing a Seq object will cause a TypeError. ↓
fix Convert Seq objects to string using str(seq) before passing to bioutils functions.
Imports
- codons wrong
import bioutils.codonscorrectfrom bioutils import codons - sequences wrong
import bioutils.sequencescorrectfrom bioutils import sequences
Quickstart
from bioutils import codons, sequences
# Translate a DNA sequence to protein
dna = "ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG"
protein = codons.translate(dna)
print(protein)
# Get reverse complement
rev_comp = sequences.reverse_complement(dna)
print(rev_comp)